Stem-loop sequence chi-mir-487a

AccessionMI0030803 (change log)
DescriptionCapra hircus miR-487a stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-487a
(1 sentences)

Stem-loop
   ---gu   cc         u     g   uua      c    -    cu  a 
5'      uag  uuugguacu gaaga ugg   ucccug ugug uucg  gu u
        |||  ||||||||| ||||| |||   |||||| |||| ||||  ||  
3'      guc  aaacuauga uuuuu acc   agggac auac aagc  ua u
   gucuc   au         c     g   uac      -    u    ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67127794-67127896 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-487a
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
Database links

Mature sequence chi-miR-487a-5p

Accession MIMAT0036246
Sequence

4 - 

agccuuugguacuugaaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-487a-3p

Accession MIMAT0036247
Sequence

59 - 

aaucauacagggacauccaguu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).