Stem-loop sequence chi-mir-485

AccessionMI0030802 (change log)
DescriptionCapra hircus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Literature search

2 open access papers mention chi-mir-485
(3 sentences)

Stem-loop
   ------caaguguccacuua  gu   u         cu       -    a    auuc 
5'                     ug  acu gaagagagg  ggccgug auga uucg    a
                       ||  ||| |||||||||  ||||||| |||| ||||    u
3'                     ac  uga uuucucucc  ucggcac uacu gagc    c
   uucgggaggcuccgucuuaa  ug   u         uc       a    -    gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67131798-67131912 [+]
intergenic
chr21: 67133472-67133586 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-485
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
Database links

Mature sequence chi-miR-485-5p

Accession MIMAT0036244
Sequence

27 - 

agaggcuggccgugaugaauuc

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-485-3p

Accession MIMAT0036245
Sequence

63 - 

agucauacacggcucuccucucu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).