Stem-loop sequence chi-mir-455

AccessionMI0030800 (change log)
DescriptionCapra hircus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

4 open access papers mention chi-mir-455
(5 sentences)

Stem-loop
   gcgagugcccgcgcccuucccuggcgugaggg         u      a   c   gaa 
5'                                 uaugugccu uggacu cau gug   g
                                   ||||||||| |||||| ||| |||    
3'                                 auauacggg accuga gua cac   c
   -------cuacuguauccggaacuccguucac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 105362304-105362416 [+]
intergenic
Database links

Mature sequence chi-miR-455-5p

Accession MIMAT0036241
Sequence

33 - 

uaugugccuuuggacuacaucg

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-455-3p

Accession MIMAT0036242
Sequence

71 - 

gcaguccaugggcauauacacu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).