Stem-loop sequence chi-mir-433

AccessionMI0030793 (change log)
DescriptionCapra hircus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

1 open access papers mention chi-mir-433
(1 sentences)

Stem-loop
   ------------------acccaguggccgg      gua   u          uuguucagagaggcuagau 
5'                                ggagaa   cgg gagccuguca                   c
                                  ||||||   ||| ||||||||||                    
3'                                ccucuu   gcu cucggguagu                   c
   cccgacggaaguaccacaccacggcgaugga      gug   c          acuaggaagaguuguuccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66962261-66962390 [+]
intergenic
chr21: 66964297-66964426 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-433
chi-mir-665chr21: 66954668-66954763 [+]
chi-mir-433chr21: 66962261-66962390 [+]
chi-mir-433chr21: 66964297-66964426 [+]
chi-mir-127chr21: 66965394-66965510 [+]
chi-mir-432chr21: 66966894-66966983 [+]
chi-mir-136chr21: 66967078-66967169 [+]
Database links

Mature sequence chi-miR-433

Accession MIMAT0036229
Sequence

73 - 

aucaugaugggcuccucggugu

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).