Stem-loop sequence chi-mir-432

AccessionMI0030792 (change log)
DescriptionCapra hircus miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

3 open access papers mention chi-mir-432
(10 sentences)

Stem-loop
   gcaugacuccu     u u     ua       g     a   uu   uu 
5'            ccaag c uggag  ggucauu ggugg ucc  uau  c
              ||||| | |||||  ||||||| ||||| |||  |||   
3'            gguuc g accuc  ucgguag ucacc ggg  gua  c
   ---------gc     u u     -c       g     -   -u   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66966894-66966983 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-432
chi-mir-433chr21: 66962261-66962390 [+]
chi-mir-433chr21: 66964297-66964426 [+]
chi-mir-127chr21: 66965394-66965510 [+]
chi-mir-432chr21: 66966894-66966983 [+]
chi-mir-136chr21: 66967078-66967169 [+]
Database links

Mature sequence chi-miR-432-5p

Accession MIMAT0036227
Sequence

17 - 

ucuuggaguaggucauugggugg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-432-3p

Accession MIMAT0036228
Sequence

64 - 

acuggauggcuccuccaugucu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).