Stem-loop sequence chi-mir-429

AccessionMI0030791 (change log)
DescriptionCapra hircus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention chi-mir-429
(5 sentences)

Stem-loop
   a   u cc        u -          cg       cu  u 
5'  gcc g  gaugggcg c uuaccagaca  guuagau  gg c
    ||| |  |||||||| | ||||||||||  |||||||  ||  
3'  cgg c  cuaccugc g aauggucugu  uaaucug  cu c
   -   - cc        c u          ca       -u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
AJPT02077529.1: 34-117 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-429
chi-mir-200aAJPT02077529.1: 1264-1351 [-]
chi-mir-429AJPT02077529.1: 34-117 [-]
Database links

Mature sequence chi-miR-429

Accession MIMAT0036226
Sequence

52 - 

uaauacugucugguaaugccg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).