Stem-loop sequence chi-mir-424

AccessionMI0030789 (change log)
DescriptionCapra hircus miR-424 stem-loop
Gene family MIPF0000164; mir-322
Literature search

5 open access papers mention chi-mir-424
(17 sentences)

Stem-loop
   ----------- cg  ga   -       a  c      aa             g  cu 
5'            u  uu  cuc caagggg ua agcagc  uucauguuuugaa ug  u
              |  ||  ||| ||||||| || ||||||  ||||||||||||| ||  u
3'            g  ga  gag guucccc au ucgucg  gagugcaaaacuu gc  a
   ugggguggaag au  ag   c       c  a      cg             g  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40346458-40346566 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-424
chi-mir-424chrX: 40346458-40346566 [-]
chi-mir-542chrX: 40340880-40340988 [-]
chi-mir-450chrX: 40339836-40339928 [-]
Database links

Mature sequence chi-miR-424-5p

Accession MIMAT0036222
Sequence

21 - 

cagcagcaauucauguuuuga

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-424-3p

Accession MIMAT0036223
Sequence

58 - 

caaaacgugaggcgcugcuau

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).