Stem-loop sequence chi-mir-423

AccessionMI0030788 (change log)
DescriptionCapra hircus miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

2 open access papers mention chi-mir-423
(4 sentences)

Stem-loop
   ----------a uu   a  aaauaa       u            -ag   g    a     cua 
5'            c  gug gg      aggaagu aggcugaggggc   aga cgag cuuuu   u
              |  ||| ||      ||||||| ||||||||||||   ||| |||| |||||   u
3'            g  cgc cc      uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   ccccucuuuga uu   g  ---cca       u            gag   g    -     ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 21574266-21574385 [+]
intergenic
Database links

Mature sequence chi-miR-423-5p

Accession MIMAT0036220
Sequence

29 - 

ugaggggcagagagcgagacuuu

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-423-3p

Accession MIMAT0036221
Sequence

65 - 

agcucggucugaggccccucagu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).