Stem-loop sequence chi-mir-421

AccessionMI0030787 (change log)
DescriptionCapra hircus miR-421 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   guauucgcagugccuaauucggugcacauu      -    uua            a   aaa 
5'                               guaggc cuca   aauguuuguuga uga   a
                                 |||||| ||||   |||||||||||| |||   a
3'                               cguccg gggu   uuacagacaacu acu   u
   ---------------guaccucuagugucu      c    uaa            -   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 72776770-72776881 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-421
chi-mir-374bchrX: 72776625-72776737 [+]
chi-mir-421chrX: 72776770-72776881 [+]
Database links

Mature sequence chi-miR-421-3p

Accession MIMAT0036219
Sequence

71 - 

aucaacagacauuaauugggcgc

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).