Stem-loop sequence chi-mir-412

AccessionMI0030786 (change log)
DescriptionCapra hircus miR-412 stem-loop
Gene family MIPF0000192; mir-412
Literature search

2 open access papers mention chi-mir-412
(3 sentences)

Stem-loop
   agggaagaacgucaguaccagcaaccacuc      a      a    c      u   aa    -    u 
5'                               ggguac ggacgg uggu gaccag ugg  agua auug u
                                 |||||| |||||| |||| |||||| |||  |||| ||||  
3'                               cccaug ccuguc auca cugguc acu  ucau uaau u
   ------------------cguccgacguca      -      g    c      c   --    g    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67142997-67143118 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-412
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-412-5p

Accession MIMAT0036217
Sequence

45 - 

uggucgaccaguuggaaaguaau

 - 67

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-412-3p

Accession MIMAT0036218
Sequence

80 - 

acuucaccugguccacuagcu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).