Stem-loop sequence chi-mir-411a

AccessionMI0030784 (change log)
DescriptionCapra hircus miR-411a stem-loop
Gene family MIPF0000126; mir-379
Literature search

2 open access papers mention chi-mir-411a
(4 sentences)

Stem-loop
   cccca     u uccu   cgucccugug       cg   a a    a      a a       - uuu 
5'      gccuc g    cgg          ugguacu  gag g uagu gaccgu u gcguacg c   a
        ||||| |    |||          |||||||  ||| | |||| |||||| | ||||||| |   u
3'      cggag c    gcc          acuauga  cuc c auca cuggca a uguaugc g   c
   -----     - uccu   -------uaa       --   c a    c      c a       a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67101691-67101817 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-411a
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
Database links

Mature sequence chi-miR-411a-5p

Accession MIMAT0036213
Sequence

44 - 

auaguagaccguauagcguac

 - 64

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-411a-3p

Accession MIMAT0036214
Sequence

80 - 

uauguaacacgguccacuaac

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).