Stem-loop sequence chi-mir-410

AccessionMI0030783 (change log)
DescriptionCapra hircus miR-410 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   caccugcggucuguggaguaggcgccacuuug      u     g    ug      a  a     - uuu 
5'                                 gguacu gagga aggu  ucugug ug guucg c   a
                                   |||||| ||||| ||||  |||||| || ||||| |   u
3'                                 ccauga cuuuu uccg  agacac au uaagc g   u
   ------------------gugcuccccaccca      -     g    gu      a  a     a uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67143473-67143597 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-410
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-410-5p

Accession MIMAT0036211
Sequence

23 - 

cgccacuuuggguacuugaggag

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-410-3p

Accession MIMAT0036212
Sequence

81 - 

aauauaacacagauggccugu

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).