Stem-loop sequence chi-mir-3959

AccessionMI0030781 (change log)
DescriptionCapra hircus miR-3959 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   auggucc     ----a      u    g  u      aga         uug 
5'        gugau     ggggag ggau gu gaucag   acauacauu   u
          |||||     |||||| |||| || ||||||   |||||||||    
3'        cacug     ucccuc ccug ca cuaguc   uguauguag   c
   --cucuu     accua      -    a  c      aac         uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67127378-67127478 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-3959
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
Database links

Mature sequence chi-miR-3959-5p

Accession MIMAT0036207
Sequence

25 - 

gguugaucagagaacauacauu

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-3959-3p

Accession MIMAT0036208
Sequence

57 - 

uguaugucaacugauccacagu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).