Stem-loop sequence chi-mir-3955

AccessionMI0030779 (change log)
DescriptionCapra hircus miR-3955 stem-loop
Gene family MIPF0002085; mir-3955
Stem-loop
   augguuugaaagugugggauacauuu     -    ucc           uau 
5'                           gaugg cuga   ucucacuacuu   a
                             ||||| ||||   |||||||||||    
3'                           cuacc gauu   agggugauggg   c
   ccacuuuuguuuagacgaacgagaua     u    -uu           uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67078969-67079074 [+]
intergenic
Database links

Mature sequence chi-miR-3955-5p

Accession MIMAT0036203
Sequence

24 - 

uuugauggcugauccucucacu

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-3955-3p

Accession MIMAT0036204
Sequence

64 - 

ugggauuuuaguccaucauagag

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).