Stem-loop sequence chi-mir-382

AccessionMI0030777 (change log)
DescriptionCapra hircus miR-382 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-382
(2 sentences)

Stem-loop
   cccugcucugucuugccucugccuuucug       u       -a           ug      - uuu 
5'                              ugguacu gaagaga  guuguucgugg  gauucg c   a
                                ||||||| |||||||  |||||||||||  |||||| |   c
3'                              accauga cuuuuuu  caacaggcacu  cuaagc g   u
   --------------gaaucuccaucauaa       -       ca           ua      a uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67130720-67130845 [+]
intergenic
chr21: 67132394-67132519 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-382
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
Database links

Mature sequence chi-miR-382-5p

Accession MIMAT0036200
Sequence

43 - 

gaaguuguucgugguggauucg

 - 64

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-382-3p

Accession MIMAT0036201
Sequence

79 - 

aaucauucacggacaacacuu

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).