Stem-loop sequence chi-mir-381

AccessionMI0030776 (change log)
DescriptionCapra hircus miR-381 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-381
(4 sentences)

Stem-loop
   agcgauggaccugcccaaugcua   cu            a  c   g        u        --g   u 
5'                        cua  guuugguacuua ag gag uugcccuu guauauuc   guu u
                          |||  |||||||||||| || ||| |||||||| ||||||||   |||  
3'                        ggu  caaacuaugagu uc cuc aacgggaa cauauaag   cag u
   ---------------cugaccca   uc            g  u   g        -        aug   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67121597-67121724 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-381
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
Database links

Mature sequence chi-miR-381

Accession MIMAT0036199
Sequence

83 - 

uauacaagggcaagcucucugu

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).