Stem-loop sequence chi-mir-379

AccessionMI0030774 (change log)
DescriptionCapra hircus miR-379 stem-loop
Gene family MIPF0000126; mir-379
Literature search

4 open access papers mention chi-mir-379
(13 sentences)

Stem-loop
   ccugauucuggggucagca  a    ----    -----uuc   c    a    a       ga       - u ugu 
5'                    cc cucc    acgg        cug agag uggu gacuaug  acguagg c g   g
                      || ||||    ||||        ||| |||| |||| |||||||  ||||||| | |    
3'                    gg gagg    ugcc        gac ucuc auca cugguac  uguaucc g c   a
   ------------------c  -    cucc    uaaccuau   -    a    c       aa       a u uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67100421-67100550 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-379
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
Database links

Mature sequence chi-miR-379-5p

Accession MIMAT0036195
Sequence

43 - 

ugguagacuauggaacguagg

 - 63

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-379-3p

Accession MIMAT0036196
Sequence

81 - 

uauguaacaugguccacuaac

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).