Stem-loop sequence chi-mir-378

AccessionMI0030773 (change log)
DescriptionCapra hircus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Literature search

7 open access papers mention chi-mir-378
(14 sentences)

Stem-loop
   gcagcca u      cagag    c    g  c              ugu      ccu 
5'        g ggguga     ccac cagg cu cugacuccaggucc   guguua   c
          | ||||||     |||| |||| || ||||||||||||||   ||||||    
3'        c uccgcu     ggug gucc ga gacugagguucagg   cacgau   g
   -----cc u      ---aa    a    g  a              --u      aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 60783373-60783482 [+]
intergenic
Database links

Mature sequence chi-miR-378-5p

Accession MIMAT0036193
Sequence

31 - 

cuccugacuccagguccugugu

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-378-3p

Accession MIMAT0036194
Sequence

69 - 

acuggacuuggagucagaaggc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).