Stem-loop sequence chi-mir-377

AccessionMI0030772 (change log)
DescriptionCapra hircus miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   aagagguaucuuggugcucagg   -u  ugac       c  ug             c   -    a    - uuu 
5'                       ccc  gc    auuugau cu  agcagagguugcc uug guga uucg c   a
                         |||  ||    ||||||| ||  ||||||||||||| ||| |||| |||| |   u
3'                       ggg  cg    uaaacua ga  uuguuuucaacgg aac cacu aagu g   u
   ---------------------a   uu  -ucc       u  gu             a   a    -    u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67139994-67140124 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-377
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-377

Accession MIMAT0036192
Sequence

85 - 

aaucacacaaaggcaacuuuug

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).