Stem-loop sequence chi-mir-376e

AccessionMI0030771 (change log)
DescriptionCapra hircus miR-376e stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention chi-mir-376e
(1 sentences)

Stem-loop
   ------  ucaau    -      c    g      a     u         - a ga 
5'       gc     guuu gauauu aaaa guggau uuccu cuauguuua c g  u
         ||     |||| |||||| |||| |||||| ||||| ||||||||| | |   
3'       cg     uaaa cuauga uuuu caccua aagga gauacaaau g c  u
   aguuuu  ---uu    u      a    a      a     -         c a ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67116496-67116601 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-376e
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
Database links

Mature sequence chi-miR-376e-5p

Accession MIMAT0036190
Sequence

23 - 

gguggauauuccuucuauguuu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-376e-3p

Accession MIMAT0036191
Sequence

61 - 

aacauagaggaaaauccacauu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).