Stem-loop sequence chi-mir-376c

AccessionMI0030769 (change log)
DescriptionCapra hircus miR-376c stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention chi-mir-376c
(1 sentences)

Stem-loop
   ggacuaaauccuuc         u    g     ua     u         uguua 
5'               uuugguauu aaaa gugga  uuccu cuauguuua     u
                 ||||||||| |||| |||||  ||||| |||||||||     u
3'               aaacuauga uuuu caccu  aagga gauacaaau     u
   --aagguucgucgu         c    g     ua     -         uggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67116853-67116964 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-376c
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
Database links

Mature sequence chi-miR-376c-5p

Accession MIMAT0036187
Sequence

29 - 

gguggauauuccuucuauguuu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-376c-3p

Accession MIMAT0036188
Sequence

67 - 

aacauagaggaaauuccacgu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).