Stem-loop sequence chi-mir-376b

AccessionMI0030768 (change log)
DescriptionCapra hircus miR-376b stem-loop
Gene family MIPF0000091; mir-368
Literature search

2 open access papers mention chi-mir-376b
(2 sentences)

Stem-loop
   ------ucuuuc         u    g      a     u     u   - guga 
5'             uuugguauu aaaa guggau uuccu cuaug uua c    u
               ||||||||| |||| |||||| ||||| ||||| ||| |     
3'             aaacuauga uuuu uaccua aagga gauac aau g    u
   aggucucaucgu         c    g      a     -     u   a auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67117609-67117712 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-376b
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
Database links

Mature sequence chi-miR-376b-5p

Accession MIMAT0036185
Sequence

21 - 

gguggauauuccuucuauguuu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-376b-3p

Accession MIMAT0036186
Sequence

59 - 

aucauagaggaaaauccau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).