Stem-loop sequence chi-mir-376a

AccessionMI0030767 (change log)
DescriptionCapra hircus miR-376a stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention chi-mir-376a
(1 sentences)

Stem-loop
      u  a   aauccuuc         u    g  a    c    u      guac   au 
5' ucc gg cag        uuugguauu aaaa gu gauu uccu cuauga    auu  u
   ||| || |||        ||||||||| |||| || |||| |||| ||||||    |||   
3' agg uc guc        aaacuauga uuuu ca cuaa agga gauacu    uag  u
      u  -   ------gu         c    g  c    a    -      -aau   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67117973-67118087 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-376a
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
Database links

Mature sequence chi-miR-376a

Accession MIMAT0036184
Sequence

34 - 

guagauucuccuucuaugagu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).