Stem-loop sequence chi-mir-374b

AccessionMI0030766 (change log)
DescriptionCapra hircus miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

1 open access papers mention chi-mir-374b
(1 sentences)

Stem-loop
   ---------------------gaagaaauccuacu    ug au             c       c 
5'                                    cgga  g  auaauacaaccug uaagugu c
                                      ||||  |  ||||||||||||| |||||||  
3'                                    gccu  u  uauuauguuggac auucacg u
   ccuuaaaucucagaccaucugcucucgguaucugu    gu ac             u       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 72776625-72776737 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-374b
chi-mir-374bchrX: 72776625-72776737 [+]
chi-mir-421chrX: 72776770-72776881 [+]
Database links

Mature sequence chi-miR-374b-5p

Accession MIMAT0036182
Sequence

22 - 

auauaauacaaccugcuaagug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-374b-3p

Accession MIMAT0036183
Sequence

52 - 

cuuaucagguuguauuaucauu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).