Stem-loop sequence chi-mir-374a

AccessionMI0030765 (change log)
DescriptionCapra hircus miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

1 open access papers mention chi-mir-374a
(1 sentences)

Stem-loop
   cuggagcagcgcccccuggaagugaauuu     c   c                        u 
5'                              uacau ggc auuauaauacaaccugauaagugu a
                                ||||| ||| ||||||||||||||||||||||||  
3'                              augug cug uaauguuauguuggacuauucacg c
   -------------------cuguccguau     u   u                        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 72713757-72713867 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-374a
chi-mir-374achrX: 72713757-72713867 [+]
chi-mir-545chrX: 72713936-72714041 [+]
Database links

Mature sequence chi-miR-374a-5p

Accession MIMAT0036180
Sequence

41 - 

uuauaauacaaccugauaagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-374a-3p

Accession MIMAT0036181
Sequence

71 - 

cuuaucagguuguauuguaauu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).