Stem-loop sequence chi-mir-369

AccessionMI0030764 (change log)
DescriptionCapra hircus miR-369 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-369
(2 sentences)

Stem-loop
   agcaucu    -----------      c   ag               ua      cuuua 
5'        cucc           ugguac uga  ggagaucgaccgugu  uauucg     u
          ||||           |||||| |||  |||||||||||||||  ||||||      
3'        gagg           acuaug acu  uuucuaguugguaca  auaagc     u
   -------    uuccacucuaa      -   cu               ua      uucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67143159-67143265 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-369
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-369-5p

Accession MIMAT0036178
Sequence

26 - 

agaucgaccguguuauauucg

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-369-3p

Accession MIMAT0036179
Sequence

61 - 

aauaauacaugguugaucuuu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).