Stem-loop sequence chi-mir-365

AccessionMI0030763 (change log)
DescriptionCapra hircus miR-365 stem-loop
Gene family MIPF0000061; mir-365
Literature search

3 open access papers mention chi-mir-365
(7 sentences)

Stem-loop
   --a  g   u  aggaca       a        ac   c       -----    u   u 
5'    ga ugc cg      gcaagaa aaugaggg  uuu aggggca     gcug guu u
      || ||| ||      ||||||| ||||||||  ||| |||||||     |||| |||  
3'    cu acg gu      cguucuu uuauuccu  aaa uccccgu     ugac cag c
   gga  -   u  ----ga       g        aa   -       aauac    u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 18731051-18731161 [-]
intergenic
Database links

Mature sequence chi-miR-365-3p

Accession MIMAT0036177
Sequence

68 - 

uaaugccccuaaaaauccuuau

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).