Stem-loop sequence chi-mir-362

AccessionMI0030761 (change log)
DescriptionCapra hircus miR-362 stem-loop
Gene family MIPF0000209; mir-362
Literature search

1 open access papers mention chi-mir-362
(1 sentences)

Stem-loop
   gagccuucuugucu    cc     -c           acc        -a ug     
5'               gcuc  ccucu  gaauccuugga   uaggugug  g  cugc 
                 ||||  |||||  |||||||||||   ||||||||  |  ||| u
3'               cgag  ggaga  cuuaggaacuu   auccacac  c  gauc 
   --------------    uc     aa           ---        aa gu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 82604414-82604511 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-362
chi-mir-502bchrX: 82604898-82604980 [-]
chi-mir-362chrX: 82604414-82604511 [-]
chi-mir-500chrX: 82603133-82603216 [-]
chi-mir-660chrX: 82601027-82601104 [-]
chi-mir-502achrX: 82599100-82599184 [-]
Database links

Mature sequence chi-miR-362-5p

Accession MIMAT0036173
Sequence

28 - 

aauccuuggaaccuaggugugagu

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-362-3p

Accession MIMAT0036174
Sequence

65 - 

aacacaccuauucaaggauuc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).