Stem-loop sequence chi-mir-361

AccessionMI0030760 (change log)
DescriptionCapra hircus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

1 open access papers mention chi-mir-361
(1 sentences)

Stem-loop
   ---ccu    uuu      uu         --u  a    u    auaa 
5'       ggga   gggagc  aucagaauc   cc gggg acuu    u
         ||||   ||||||  |||||||||   || |||| ||||    u
3'       uccu   ccuucg  uagucuuag   gg cccc ugaa    u
   uccucc    cuu      uu         ugu  a    c    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 62289151-62289246 [+]
intergenic
Database links

Mature sequence chi-miR-361-5p

Accession MIMAT0036171
Sequence

17 - 

uuaucagaaucuccagggguac

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-361-3p

Accession MIMAT0036172
Sequence

55 - 

ucccccaggugugauucugauu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).