Stem-loop sequence chi-mir-34c

AccessionMI0030759 (change log)
DescriptionCapra hircus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Literature search

5 open access papers mention chi-mir-34c
(8 sentences)

Stem-loop
   ---------------------u      ag     a   a    a     c      c  a 
5'                       gagucu  uuacu ggc gugu guuag ugauug ua u
                         ||||||  ||||| ||| |||| ||||| |||||| ||  
3'                       uuuaga  aaugg ccg caca caauc acuaac au a
   gucgaguaaaccuacuuaaggg      aa     a   g    c     -      c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 21773345-21773446 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-34c
chi-mir-34bchr15: 21772625-21772730 [+]
chi-mir-34cchr15: 21773345-21773446 [+]
Database links

Mature sequence chi-miR-34c-5p

Accession MIMAT0036169
Sequence

15 - 

aggcaguguaguuagcugauugc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-34c-3p

Accession MIMAT0036170
Sequence

48 - 

aaucacuaaccacacggccagg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).