Stem-loop sequence chi-mir-34a

AccessionMI0030757 (change log)
DescriptionCapra hircus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

5 open access papers mention chi-mir-34a
(9 sentences)

Stem-loop
   gg -    u   -  ug     uu        -   a          guga   a 
5'   c cagc gug ag  uuucu  ggcagugu cuu gcugguuguu    gua u
     | |||| ||| ||  |||||  |||||||| ||| ||||||||||    |||  
3'   g guug cac uc  gaaga  ccgucaua gaa cgacuaacga    cgu a
   gg u    -   g  gu     uc        u   -          agga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 44326265-44326371 [+]
intergenic
Database links

Mature sequence chi-miR-34a

Accession MIMAT0036166
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).