Stem-loop sequence chi-mir-346

AccessionMI0030756 (change log)
DescriptionCapra hircus miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
   ----------------g u      g ug    u    cu    -  aug        u  guug 
5'                  g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
                    | |||||| |  |||| ||||  |||| ||   |||||||| ||     
3'                  c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
   acagggugcguccuagg -      - gu    c    uu    u  --g        -  aguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr28: 40878616-40878725 [-]
intergenic
Database links

Mature sequence chi-miR-346-5p

Accession MIMAT0036165
Sequence

20 - 

ugucugcccgcaugccugccucu

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).