Stem-loop sequence chi-mir-345

AccessionMI0030755 (change log)
DescriptionCapra hircus miR-345 stem-loop
Gene family MIPF0000189; mir-345
Stem-loop
   -------  gacc             g u          c   u   ug g u 
5'        ga    caaacccaggucu c gacuccuagu cag gcu  u a g
          ||    ||||||||||||| | |||||||||| ||| |||  | |  
3'        cu    guuuggguccgga g cuggggauca guc cgg  g u g
   ccgacca  auaa             g u          a   c   gu g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66338630-66338730 [+]
intergenic
Database links

Mature sequence chi-miR-345-5p

Accession MIMAT0036163
Sequence

20 - 

gcugacuccuaguccagugcu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-345-3p

Accession MIMAT0036164
Sequence

57 - 

cccugaacuaggggucuggagg

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).