Stem-loop sequence chi-mir-3431

AccessionMI0030753 (change log)
DescriptionCapra hircus miR-3431 stem-loop
Gene family MIPF0002046; mir-3431
Literature search

1 open access papers mention chi-mir-3431
(1 sentences)

Stem-loop
   auacccaa    u c     cc        -    g       -au   c 
5'         ugaa g gaaaa  ucagucag ccuu uggaugu   guu u
           |||| | |||||  |||||||| |||| |||||||   ||| g
3'         acuu c cuuuu  agucaguc ggag aucuaca   cag c
   ---aaucg    u a     aa        a    -       guc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 56573960-56574056 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-3431
chi-mir-224chrX: 56575904-56575984 [-]
chi-mir-3431chrX: 56573960-56574056 [-]
Database links

Mature sequence chi-miR-3431-5p

Accession MIMAT0036159
Sequence

21 - 

ccucagucagccuuguggaugu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-3431-3p

Accession MIMAT0036160
Sequence

61 - 

aucuagaggacugacugaaauu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).