Stem-loop sequence chi-mir-340

AccessionMI0030751 (change log)
DescriptionCapra hircus miR-340 stem-loop
Gene family MIPF0000191; mir-340
Literature search

1 open access papers mention chi-mir-340
(1 sentences)

Stem-loop
   ---------guuu     u      au       -caa      u    g     ug 
5'              guacc ggugug  uauaaag    ugagac gauu ucaug  u
                ||||| ||||||  |||||||    |||||| |||| |||||  c
3'              uaugg ccauac  auauuuc    acucug cuag ggugu  g
   agacaccauauuc     u      cg       auug      c    -     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 899623-899728 [+]
intergenic
Database links

Mature sequence chi-miR-340-5p

Accession MIMAT0036155
Sequence

18 - 

uuauaaagcaaugagacugauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-340-3p

Accession MIMAT0036156
Sequence

60 - 

uccgucucaguuacuuuauagc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).