Stem-loop sequence chi-mir-33b

AccessionMI0030750 (change log)
DescriptionCapra hircus miR-33b stem-loop
Gene family MIPF0000070; mir-33
Literature search

2 open access papers mention chi-mir-33b
(3 sentences)

Stem-loop
   ---------gcggg    c   c  -          uu         g  u 
5'               cggc ccg gg ugcauugcug  gcauugcau ug g
                 |||| ||| || ||||||||||  ||||||||| || a
3'               gccg ggc cc acgugacggc  cgugacgug ac g
   cgccacgguccccg    a   -  g          uc         g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 35556884-35556977 [+]
intergenic
Database links

Mature sequence chi-miR-33b-5p

Accession MIMAT0036153
Sequence

16 - 

gugcauugcuguugcauug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-33b-3p

Accession MIMAT0036154
Sequence

52 - 

cagugccucggcagugcagcc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).