Stem-loop sequence chi-mir-33a

AccessionMI0030749 (change log)
DescriptionCapra hircus miR-33a stem-loop
Gene family MIPF0000070; mir-33
Literature search

4 open access papers mention chi-mir-33a
(9 sentences)

Stem-loop
   -----ug   c          a uu          -uu    
5'        cug ggugcauugu g  gcauugcaug   ccg 
          ||| |||||||||| |  ||||||||||   || g
3'        gac cuacgugaca c  uguaacgugc   ggc 
   guccgga   a          c uu          cac    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 114359915-114359991 [+]
intergenic
Database links

Mature sequence chi-miR-33a-5p

Accession MIMAT0036151
Sequence

8 - 

gugcauuguaguugcauugc

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-33a-3p

Accession MIMAT0036152
Sequence

47 - 

caauguuuccacagugcauca

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).