Stem-loop sequence chi-mir-335

AccessionMI0030747 (change log)
DescriptionCapra hircus miR-335 stem-loop
Gene family MIPF0000196; mir-335
Literature search

2 open access papers mention chi-mir-335
(6 sentences)

Stem-loop
   --------cuuu    c        a         c        u  gu 
5'             uggg ggggguca gagcaauaa gaaaaaug uu  c
               |||| |||||||| ||||||||| |||||||| ||   
3'             acuc ccuccagu cucguuauu cuuuuugc aa  a
   cuuaugucguuu    u        c         a        c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 96880780-96880871 [+]
intergenic
Database links

Mature sequence chi-miR-335-5p

Accession MIMAT0036147
Sequence

15 - 

ucaagagcaauaacgaaaaau

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-335-3p

Accession MIMAT0036148
Sequence

51 - 

uuuuucauuauugcuccugacc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).