Stem-loop sequence chi-mir-331

AccessionMI0030746 (change log)
DescriptionCapra hircus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

1 open access papers mention chi-mir-331
(1 sentences)

Stem-loop
   cacucccaaggaguu  -  uuu         u        u    u       au ccaga 
5'                ug gu   guuuggguu guucuagg augg cccaggg  c     u
                  || ||   ||||||||| |||||||| |||| |||||||  |     c
3'                ac cg   caaauccaa caagaucc uauc ggguccc  g     a
   -------------cu  g  -cu         c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 25579261-25579371 [+]
intergenic
Database links

Mature sequence chi-miR-331-5p

Accession MIMAT0036145
Sequence

35 - 

ucuagguauggucccagggau

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-331-3p

Accession MIMAT0036146
Sequence

72 - 

ccccugggccuauccuagaac

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).