Stem-loop sequence chi-mir-329b

AccessionMI0030744 (change log)
DescriptionCapra hircus miR-329b stem-loop
Gene family MIPF0000110; mir-329
Literature search

1 open access papers mention chi-mir-329b
(1 sentences)

Stem-loop
   cacugguguucuggucaguguucaccca      cu           uu ug   uuc      u  aa 
5'                             ugguac  gaagagagguu  c  ggu   uguuuc uu  u
                               ||||||  |||||||||||  |  |||   |||||| ||   
3'                             acuaug  cuuuucuccaa  g  cca   acaaag ag  g
   --------------aaguucuacccuaa      ac           uu gu   --c      u  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67105074-67105197 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-329b
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
Database links

Mature sequence chi-miR-329b-3p

Accession MIMAT0036142
Sequence

79 - 

aacacaccugguuaaccucu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).