Stem-loop sequence chi-mir-329a

AccessionMI0030743 (change log)
DescriptionCapra hircus miR-329a stem-loop
Gene family MIPF0000110; mir-329
Literature search

1 open access papers mention chi-mir-329a
(1 sentences)

Stem-loop
   ---ca   ua   gg       u           uu      cucc     u   a 
5'      gug  auu  ugguacu gaggagagguu  cuaggu    guuuc uuc u
        |||  |||  ||||||| |||||||||||  ||||||    ||||| |||  
3'      cac  uag  acuauga cuuuuuuccaa  ggucca    caaag agg g
   gguuc   cc   --       c           uu      --ca     u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67105386-67105492 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-329a
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
Database links

Mature sequence chi-miR-329a-5p

Accession MIMAT0036140
Sequence

7 - 

aauuggugguacuugagga

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-329a-3p

Accession MIMAT0036141
Sequence

63 - 

aacacaccugguuaaccuuu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).