Stem-loop sequence chi-mir-323b

AccessionMI0030739 (change log)
DescriptionCapra hircus miR-323b stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-323b
(1 sentences)

Stem-loop
   gcgugcugcugcacu       u            c     gccc  u  -   u 
5'                ugaugcu gaggagagguug ccgug    gu cg cau c
                  ||||||| |||||||||||| |||||    || || ||| u
3'                acuaugg cuucucuccggc ggcac    ca gc gua u
   -acguuccacccuaa       -            u     auaa  c  u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67144000-67144109 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-323b
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-323b

Accession MIMAT0036134
Sequence

65 - 

cacaauacacggucggccucu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).