Stem-loop sequence chi-mir-323a

AccessionMI0030738 (change log)
DescriptionCapra hircus miR-323a stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-323a
(1 sentences)

Stem-loop
   ggugucagcacugcugcugcuu      u g        g u     gcgc  u    uua 
5'                       gguacu g agagaggu g ccgug    gu cgcu   u
                         |||||| | |||||||| | |||||    || ||||    
3'                       cuaugg c uuucucca c ggcac    ca gcgg   u
   ---------guuccgcccuaau      - g        g u     auua  c    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67104063-67104176 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-323a
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
Database links

Mature sequence chi-miR-323a-3p

Accession MIMAT0036133
Sequence

71 - 

cacauuacacggucgaccucu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).