Stem-loop sequence chi-mir-320

AccessionMI0030737 (change log)
DescriptionCapra hircus miR-320 stem-loop
Gene family MIPF0000163; mir-320
Literature search

4 open access papers mention chi-mir-320
(4 sentences)

Stem-loop
   gcg    g   -g   ---c         uu       c      g 
5'    ucuc cuc  ccu    cgccuucuc  cccgguu uucccg a
      |||| |||  |||    |||||||||  ||||||| ||||||  
3'    aggg gag  gga    gcgggagag  gggucga aagggc g
   ---    -   aa   aaaa         uu       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 70376303-70376388 [-]
intergenic
Database links

Mature sequence chi-miR-320-3p

Accession MIMAT0036132
Sequence

50 - 

aaaagcuggguugagagggcga

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).