Stem-loop sequence chi-mir-30f

AccessionMI0030736 (change log)
DescriptionCapra hircus miR-30f stem-loop
Gene family MIPF0000005; mir-30
Literature search

6 open access papers mention chi-mir-30f
(11 sentences)

Stem-loop
   g     c   uacu       c   aca         -gug a 
5'  agggc aga    guaaaca ccu   cucucagcu    c c
    ||||| |||    ||||||| |||   |||||||||    | a
3'  uuccg ucu    cauuugu gga   gagggucga    g g
   -     -   cucu       c   --g         aaga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 2554762-2554845 [+]
intergenic
Database links

Mature sequence chi-miR-30f-5p

Accession MIMAT0036130
Sequence

14 - 

uguaaacacccuacacucucagc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-30f-3p

Accession MIMAT0036131
Sequence

54 - 

cugggaggaggcuguuuacucu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).