Stem-loop sequence chi-mir-30e

AccessionMI0030735 (change log)
DescriptionCapra hircus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

6 open access papers mention chi-mir-30e
(68 sentences)

Stem-loop
   -----uu   -        uu  ua            uu           g aag    
5'        cug ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   gcg 
          ||| ||||||||  ||  ||||||||||||  ||||||||||| |   || u
3'        ggc ccgucgga  cg  gacauuuguagg  cugacuuucga g   cgu 
   cccuacu   a        --  gc            --           g -aa    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr3: 107747145-107747250 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-30e
chi-mir-30echr3: 107747145-107747250 [-]
chi-mir-30cchr3: 107744025-107744129 [-]
Database links

Mature sequence chi-miR-30e-5p

Accession MIMAT0036128
Sequence

21 - 

uguaaacauccuugacuggaagcu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-30e-3p

Accession MIMAT0036129
Sequence

63 - 

cuuucagucggauguuuacag

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).