Stem-loop sequence chi-mir-30d

AccessionMI0030734 (change log)
DescriptionCapra hircus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

7 open access papers mention chi-mir-30d
(14 sentences)

Stem-loop
   a    u  u  u         ccc           guucca 
5'  aguc gu gu guaaacauc   gacuggaagcu      c
    |||| || || |||||||||   |||||||||||       
3'  ucgg ca cg cguuuguag   cugacuuucga      a
   -    c  u  u         --a           aucgac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 17697089-17697169 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-30d
chi-mir-30dchr14: 17697089-17697169 [+]
chi-mir-30bchr14: 17702995-17703083 [+]
Database links

Mature sequence chi-miR-30d-3p

Accession MIMAT0036127
Sequence

53 - 

uuucagucagauguuugcugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).