Stem-loop sequence chi-mir-30c

AccessionMI0030733 (change log)
DescriptionCapra hircus miR-30c stem-loop
Gene family MIPF0000005; mir-30
Literature search

5 open access papers mention chi-mir-30c
(10 sentences)

Stem-loop
   ca   u  -aa     cc    ugu u       u   aca        ug gag 
5'   gac gu   ccaug  guag   g guaaaca ccu   cucucagc  u   c
     ||| ||   |||||  ||||   | ||||||| |||   ||||||||  |   u
3'   cug ca   gguac  cguc   c cauuugu ggg   gagggucg  g   c
   --   -  aaa     --    uuc u       u   --a        gu gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr3: 107744025-107744129 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-30c
chi-mir-30echr3: 107747145-107747250 [-]
chi-mir-30cchr3: 107744025-107744129 [-]
Database links

Mature sequence chi-miR-30c-5p

Accession MIMAT0036125
Sequence

26 - 

uguaaacauccuacacucucagc

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-30c-3p

Accession MIMAT0036126
Sequence

65 - 

cugggagaggguuguuuacuc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).