Stem-loop sequence chi-mir-30b

AccessionMI0030732 (change log)
DescriptionCapra hircus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

6 open access papers mention chi-mir-30b
(13 sentences)

Stem-loop
   a      uuc     cau          u  -a        ua  ac 
5'  ccaagu   caguu   guaaacaucc ac  cucagcug  ac  u
    ||||||   |||||   |||||||||| ||  ||||||||  ||   
3'  gguuca   gucga   cauuuguagg ug  gggucggc  ug  u
   a      ---     cuu          -  ga        --  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 17702995-17703083 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-30b
chi-mir-30dchr14: 17697089-17697169 [+]
chi-mir-30bchr14: 17702995-17703083 [+]
Database links

Mature sequence chi-miR-30b-5p

Accession MIMAT0036123
Sequence

18 - 

uguaaacauccuacacucagcu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-30b-3p

Accession MIMAT0036124
Sequence

56 - 

cugggagguggauguuuacuuc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).