Stem-loop sequence chi-mir-30a

AccessionMI0030731 (change log)
DescriptionCapra hircus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

8 open access papers mention chi-mir-30a
(14 sentences)

Stem-loop
   uc   -------   a    g                 uc           ---g  ag 
5'   ccu       gug cagu agcggcuguaaacaucc  gacuggaagcu    ug  g
     |||       ||| |||| |||||||||||||||||  |||||||||||    ||   
3'   gga       cgc guca ucgucgacguuuguagg  cugacuuucgg    ac  c
   -a   cugcacc   c    g                 --           aaag  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr14: 2517238-2517344 [+]
intergenic
Database links

Mature sequence chi-miR-30a-5p

Accession MIMAT0036121
Sequence

21 - 

uguaaacauccucgacuggaagcu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-30a-3p

Accession MIMAT0036122
Sequence

62 - 

cuuucagucggauguuugcag

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).